MediumBiologyHigh School (11–12)BiotechnologyNumerical

In a model of RNA interference, the amount of a nematode mRNA that is left in a cell is m₀/(1 +…

Try it on paper first. A hint, the key idea and the worked solution are here when you need them.

In a model of RNA interference, the amount of a nematode mRNA that is left in a cell is $\dfrac{m_0}{1 + 0.15\,d}$ . Here $m_0$ is the amount at the start, and $d$ is the level of matching dsRNA in arbitrary units. A cell starts with $600$ molecules of the mRNA.

How many molecules are left when $d = 20$ ?

What per cent of the mRNA is silenced when $d = 20$ ?

How many molecules are left when $d = 60$ ?

Need a reminder? The key ideaShow

RNA interference (RNAi) is a defence of eukaryotic cells. A double stranded RNA that is complementary to a messenger RNA silences it, so the mRNA is not translated. In tobacco, a nematode gene was introduced with an Agrobacterium vector so that the plant made both sense and antisense RNA. These formed double stranded RNA, and the nematode could not survive on the plant. In double stranded RNA, A pairs with U by 2 hydrogen bonds and G pairs with C by 3.

The worked solution

Have you tried it?

Work it out on paper first. It is fine to get stuck or make a mistake: that is how we learn. When you are ready, go through the solution one step at a time, and check each step against your own.

← All Problems

← A sense RNA from a nematode gene reads AUGGCCUAAGGCUUACGCGA…In the tobacco experiment the inserted DNA was arranged to make both sense and antisense RNA of a… →

More onBiotechnology

Discussion (0)

Loading…