A sense RNA from a nematode gene reads AUGGCCUAAGGCUUACGCGA…
Contributed by StemPy LabTry it on paper first. A hint, the key idea and the worked solution are here when you need them.
A sense RNA from a nematode gene reads AUGGCCUAAGGCUUACGCGA. It is bases long.
- Write the antisense RNA.
- How many of the bases of the sense strand are G or C?
- How many hydrogen bonds hold the two strands together when they pair along the whole length?
Need a reminder? The key ideaShow
RNA interference (RNAi) is a defence of eukaryotic cells. A double stranded RNA that is complementary to a messenger RNA silences it, so the mRNA is not translated. In tobacco, a nematode gene was introduced with an Agrobacterium vector so that the plant made both sense and antisense RNA. These formed double stranded RNA, and the nematode could not survive on the plant. In double stranded RNA, A pairs with U by 2 hydrogen bonds and G pairs with C by 3.
The worked solution
Have you tried it?
Work it out on paper first. It is fine to get stuck or make a mistake: that is how we learn. When you are ready, go through the solution one step at a time, and check each step against your own.
Given. Sense RNA: AUGGCCUAAGGCUUACGCGA.
Plan. Write the partner of each base, count the G and C bases, and then count the bonds.
Step 1. The antisense strand. The partners are: A-U, U-A, G-C, G-C, C-G, C-G, U-A, A-U, A-U, G-C, G-C, C-G, U-A, U-A, A-U, C-G, G-C, C-G, G-C, A-U. The antisense RNA is UACCGGAUUCCGAAUGCGCU.
Step 2. G and C bases. There are of them, so are A or U.
Step 3. Bonds. .
Answer: UACCGGAUUCCGAAUGCGCU; ; hydrogen bonds.
Check. If all pairs were A and U, there would be bonds. If all were G and C, there would be . The answer lies between them.
More onBiotechnology
Discussion (0)
Log in to join the discussion.
Loading…