A student designs a primer of 20 bases, GCTAGCAAGGGCGAGGAGCT…
Contributed by StemPy LabTry it on paper first. A hint, the key idea and the worked solution are here when you need them.
A student designs a primer of bases, GCTAGCAAGGGCGAGGAGCT. It has G and C bases. Use .
- What is the share of G and C?
- What is the Tm?
- What annealing temperature would you start with?
- Does the primer follow all the rules? Say which rule it breaks.
Need a reminder? The key ideaShow
A primer has 18 to 25 bases, 40 to 60 per cent G and C, and a G or C at the 3 prime end. , and the annealing temperature is about 5 degrees Celsius below it. Extension takes about 1 minute for each kilobase. The number of bases between the start codon and the insert must be a multiple of 3.
The worked solution
Have you tried it?
Work it out on paper first. It is fine to get stuck or make a mistake: that is how we learn. When you are ready, go through the solution one step at a time, and check each step against your own.
Given. and .
Plan. Use the formula, and check the rules.
Step 1. (a) per cent.
Step 2. (b) degrees Celsius.
Step 3. (c) degrees Celsius.
Step 4. (d) The length is fine. The share of G and C is per cent, which is above the range of to per cent. Also, the 3 prime end is T, and a G or C is better.
Answer: per cent; degrees Celsius; degrees Celsius; it breaks the G and C rule, and the 3 prime end is not G or C.
Check. A primer with too many G and C may pair in the wrong places.
More onBiotechnology
Discussion (0)
Log in to join the discussion.
Loading…